Technologie, Transhumanismus, Augmented Reality

Desardh

Senior Community Officer
Teammitglied
Transhumanismus ("Veränderung der menschlichen Spezies durch den Einsatz technologischer Verfahren" - wikipedia) ist ein interessantes und weitläufiges, aber auch umstrittenes Thema. Die meisten setzen sich wohl erst seit Deus Ex: Human Revolution damit auseinander, aber das ist unwichtig. Dieses Thema gewinnt immer mehr an Bedeutung, es werden stetig Fortschritte gemacht und es werden große Durchbrüche in den nächsten Jahrzehnten erwartet.

Von Bio- und Nanotechnologie über Kryonik und Stammzellenforschung bis hin zu künstlicher Intelligenz und dem Transferieren von menschlichem Bewusstsein in digitale Speicher, deckt dieses Themengebiet mehr oder weniger alles ab, was den Einsatz von Technologie zur Verbesserung oder Weiterentwicklung des Menschen angeht.

Das meiste davon sind möglicherweise nur Wunschträume von Transhumanisten, aber anderes ist schon in greifbarer Nähe und teilweise schon real. Wenn man zum Beispiel an Prothesen für den Menschlichen Körper denkt, welche Gliedmaßen in ihrer Funktion ersetzen sollen. Aber es geht auch noch weiter. Implantate von Mikrochips, die Menschen zu natürlichen Fähigkeiten verhelfen, werden schon ausgiebig getestet und sind teilweise schon im Einsatz. Ein Retinachip beispielsweise, der Blinden wieder das sehen ermöglicht.

SPIEGEL ONLINE: Tübinger Ärzte verhelfen Blinden zum Sehen
SPIEGEL ONLINE: Digitales Wiedersehen

http://www.pictureupload.de/originals/pictures/300811114000_236515.jpg.332585.jpg http://www.pictureupload.de/originals/pictures/300811114059_image-42911-bigimage420-nvhh.jpg

Arm- und Beinprothesen gibt es schon länger und werden den menschlichen Gliedmaßen immer ähnlicher. Sie werden durch Muskelspannungen oder sogar durch Gedanken gesteuert. Auch der Tastsinn und messbare Temperaturunterschiede sind schon möglich.

HEISE ONLINE: Prothese mit Gefühl

Sehr interessant und auch nicht allzu lang ist die Eyeborg Documentary, die für Deus Ex angefertigt wurde. Beinhaltet auch den Kerl mit dem Retinachip. Sollte man mal rein schauen, hat mit dem Spiel natürlich weniger zu tun, zeigt aber, was heutzutage schon alles möglich ist. Vielleicht ist die Technik auch schon noch viel entwickelt, als man es uns wissen lassen will.

Recommented content - Youtube An dieser Stelle findest du externe Inhalte von Youtube. Zum Schutz deiner persönlichen Daten werden externe Einbindungen erst angezeigt, wenn du dies durch Klick auf "Alle externen Inhalte laden" bestätigst: Ich bin damit einverstanden, dass mir externe Inhalte angezeigt werden. Damit werden personenbezogene Daten an Drittplattformen übermittelt. For more information go to the privacy policy.

Es gibt Befürworter und natürlich Gegner des Transhumanismus. Die einen sehen die Verbesserung der Lebensqualität der Menschen, die es wollen, die anderen sehen die Entstehung einer Klassengesellschaft und moralische, sowie ethische Probleme mit sich kommen.

Was wird, wenn die Technik einmal so weit ist, dass sich die Verbesserung des menschlichen Körpers so weit etabliert hat? Entsteht wirklich eine Klassengesellschaft zwischen normalen Menschen und "besseren" Menschen oder ist das eine übertriebene Darstellung? Ist die Kontrolle und das Eingreifen in die menschliche Spezies verwerflich oder ein hilfreiches Mittel zum Zweck?

Wenn Blinde wieder sehen können und Behinderte wieder laufen, ist das eine gute Sache. Aber die Frage ist, ob die Technologie nicht ausgenutzt werden könnte. Denn der Einsatz dieser Technologie kann weit über das Austauschen von Körperteilen hinaus gehen. Mit Stammzellenforschung und Genmanipulation kann man schon von Züchtung einer verbesserten menschlichen Spezies sprechen und das haben schon die Nationalsozialisten angestrebt. Solange das aber nicht in der Hand eines Staates liegt, sondern freiwillig jedem selbst überlassen wird, ist doch eigentlich alles in Ordnung... natürlich bis auf die moralischen und ethischen Einwände, aber auch das muss jeder für sich selbst entscheiden.

Ich halte den technologischen Fortschritt für notwendig und im Allgemeinen für eine gute Sache, auch wenn es vielleicht Gefahren mit sich bringt. Wenn ich nach einem Unfall die Wahl hätte im Rollstuhl zu sitzen, oder mir Beinprothesen (vorausgesetzt ich kann es mir leisten) einsetzen zu lassen, würde ich es natürlich tun. Genau so würde ich mir ein mechanisches Auge einsetzen lassen oder andere Körperteile, die ihre Arbeit nicht mehr verrichten können, ersetzen lassen.

Ich bin mal gespannt, wie sich die Technologie und der Einsatz dieser in den kommenden Jahren und Jahrzehnten entwickelt. Wahrscheinlich nicht so wie in Human Revolution, aber in einigen Jahrzehnten sieht die Welt in diesen Belangen sicher ganz anders aus als heute...
 

The-Masterpiece

Bekanntes Gesicht
erstmal sehr geiles thema.....wer hat dich da nur auf die idee gebracht so einen genialen thread zu eröffnen?

ich bin dem thema zwiegespalten. der sprung der technologien ist massiv und gewisserweise beeindruckend, besonders in der medizin. andererseits seh ich es schon kommen, dass später die neuen und "besseren" geräte in der medizin für normalverdiener bzw. in der zeit für die unterschicht nicht zu leisten sind. da stellt sich wieder die frage ob die gesundheit eines menschen über dem geld oder weit drunter ist.
aber es ist schon wahnsinn wie weit wir sind, besonders das mit dem implantat in der retina ist echt heftig. als nächsten negativen punkt, welchen ich letztens in einer seriösen zeitschrift (penthouse %) ) gelesen hab ist, das vieles hinter den kulissen vor uns verschwiegen wird z.b. 50 zoll bildschirm welcher 3d ohne brille wiedergibt oder ala kinect steuerung des hauses.

ich bin gespannt was noch alles in den nächsten jahren auf uns zu kommt. im positiven sowie im negativen.
 

n-zoneAffe

Bekanntes Gesicht
Habe mich schon sehr oft mit Transhumanismus beschäftigt und ja, es ist wirklich ein sehr geiles Thema :-D
Auch die Idee von Robotern die ein Menschliches Gehirn haben usw.

Zu dem Thema kann man den Film "Nummer 9" gucken, das ist in etwa transhumanistisch.

Man stelle sich vor wir hätten die Unterstützung bionischer Gelenke und Muskeln, man kann sich wissen mit Microchips ins Gehirn laden oder irgendwelche Fähigkeiten updaten. Hehe, man kann gar nicht genug Gott spielen %)
 

gamechris

Bekanntes Gesicht
"Wir sind die Borg! Wir werden Ihre biologischen und technologischen Charaktertistika den unsrigen hinzufügen. Widerstand ist zwecklos!"

Wie auch immer, ich hätte nichts gegen Technik-Krimskrams im Körper. Auch net z.B. gegen einen Chip im Hirn, auf dem das ganze Wissen der Menschheit gespeichert ist (also Wikipedia *g*). Dann würde man sich das lästige, lebenslange lernen sparen.

Aber wenn man sieht, wie sich manche Möchtegern-Datenschützer über weit geringere Dinge aufregen (z.B. ein Handy, mit dem man evtl. geortet werden kann), dann wird's wohl nie Computerchips im menschlichen Körper gehen.
 

Desardh

Senior Community Officer
Teammitglied
z.B. einen Chip im Hirn, auf dem das ganze Wissen der Menschheit gespeichert ist (also Wikipedia *g*). Dann würde man sich das lästige, lebenslange lernen spare.

Ich weiß nicht, ob das eine so gute Idee wäre. Dinge zu lernen gehört zum Leben dazu. Das wäre auf jeden Fall unnatürlich. Außerdem, wie sagt man so schön, "Wissen ist Macht". Wenn jeder über das gesamte Wissen der Menschheit verfügt, würde das wohl eher dem Gemeinwohl schaden als helfen.
 

Beefi

Bekanntes Gesicht
Ich weiß nicht, ob das eine so gute Idee wäre. Dinge zu lernen gehört zum Leben dazu. Das wäre auf jeden Fall unnatürlich. Außerdem, wie sagt man so schön, "Wissen ist Macht". Wenn jeder über das gesamte Wissen der Menschheit verfügt, würde das wohl eher dem Gemeinwohl schaden als helfen.
Dann hätten wir wohl 10 Milliarden Diktatoren auf der Erde. Sehr interessantes Thema, ich werd mich nochmal dazu äußern, hab grad zu wenig Zeit. ^^
 
R

Retro-Fan

Gast
Irgendwie hab ich das Gefühl, du hast das Thema von einem Spiel aufgegriffen, welches du momentan sehr ausgiebig zockst :B
Doch uninteressant ist es keinesfalls, im Gegenteil.

Ich denke, in ferner Zukunft wird vielen Menschen ein "normales" Leben wieder ermöglicht werden, dank der dann vorhandenen Technologie.
Alleine wenn ich mir in Dokumentationen, oder auf YouTube ansehe, was heutige Prothesen alles bewerkstelligen, dazu noch deren immer natürlicher werdendes Aussehen, bin ich echt beeindruckt, eben, wie du es auch schon sagtest.
Was ich aber auch auf lange Sicht noch sehe, sind die enormen Kosten, die der Käufer für solche Technik auf den Tisch legen muss, wozu noch kommt, dass sie noch längst nicht, wenn auch fortgeschritten, ausgereift ist.

Mir persönlich gefällt einerseits die Idee, das man älteren Menschen und auch Leuten, welche eine Behinderung haben, auf dieser Weise wieder helfen kann, selbst wenn es nur ein typischer Windows-Rechner mit Mikrofon und Sprachein/ausgabe ist.

Genauso bergt der Drang, so etwas zu entwickeln, natürlich auch seine Gefahren, so, wie ihr es hier auch erwähnt habt, bereits :B

Vielleicht ist mein Gehirn in dieser Hinsicht auch etwas verblendet, von etlichen Serien und Filmen, welche ich bereits gesehen hab.
Doch da der Mensch immer weiter möchte, immer höhere Ziele erreichen will, wie man an Geschichten wie diesem LHC bereits sehen kann, würde es mich nicht wundern, das, sollte die Technik wirklich eines Tages auf ihrem Höchststand sein, der Mensch auch noch im letzten möglichen versucht, die Götter zu übertreffen.
Wäre nicht das erste mal, dass die Menschheit dies versucht und dank vorhandener Technik, welche dem Mensch noch mächtiger macht, ja vielleicht sogar übermenschliche/unnatürliche Fähigkeiten schenken kann, bestimmt auch nicht das letzte mal.

Als erstes würde alles natürlich auf dem Schlachtfeld ausprobiert, wo immer mehr normale Soldaten zu Halb-Maschinen umfunktioniert würden, schlicht durch die vielen Verletzungen, im Kampf.
Dann irgendwann wird es auch die Zivilbevölkerung erreichen, wo dann nicht mehr der Drang nach besseren Medikamenten, einer gesunden Ernährung oder viel körperlicher Betätigung, sondern immer neuen Ersatzteilen, ganz im Sinne des Computers, besteht.

So ist meine Vorstellung.

Hoffentlich trifft diese Vision niemals ein, denn was im Film/Spiel klappt, sieht in der Realität häufig anders aus.

Doch zustimmen muss ich, die Technik hat sich in den letzten Jahren, rapide verbessert :]
 

PSYCHOBUBE

Bekanntes Gesicht
Medizinisch gesehen sind diese neue Technologien klasse, wenn so etwas wirklich Realität werden sollte, dann sollten solche Dinge über Krankenkassen finanziert werden, damit auch die sozialschwachen Menschen davon profitieren können. sonst ist es ungerecht.

Ethisch würde ich sagen, solange sie nur für medizinischen Zwecken eingesetzt werden, habe ich auch keine Bedenken.
Aber so etwas sollte meiner Meinung nach nur angewendet werden, wenn es wirklich nötig ist. Sowohl körperlich als auch psychisch. Und nicht um Gott zu spielen.

Viele Sci-Fi Filme bzw. Romane beschäftigen sich kritisch mit diesem Thema. Finde ich gut.

Zu guter letzt: Ich muss an Data aus Star Trek denken. Für alle die Star Trek nicht kennen: Data ist ein Androide, der keine Emotionen hat aber welche haben möchte und menschlich sein möchte. Er ist etwas wie ein Kind, der die Welt der Menschen entdeckt. Durch seine Bemühungen und fehlende Gefühle hat er das Talent in jedem Fettnäpfchen zu treten, wo man reintreten kann. Seine Bemühungen und seine Ehrlichkeit machen aus ihm ein sehr guten Freund.
Warum ich bei diesem Thread an ihn denke? In der ersten Folge redeten er und Riker über Überlegenheit, da Data ein Androide ist. Folgender Satz, dass er Riker sagte, ist mir in Gedächtnis geblieben: "Ich bin euch überlegen, aber ich würde das alles eintauschen um Menschlicher zu sein."
 

PSYCHOBUBE

Bekanntes Gesicht
Darüber habe ich auch schon gelesen, bei GMX. Und da auch meinen Senf hinzugegeben :-D

Für rein medizinische Zwecke, wie zum Beispiel damit ein Blinder wieder sehen kann, find ichs ganz gut.

Aber wenn es nur zur Bequemlichkeit dient.... Ziemlich unheimlich. Bei aller Liebe zur Technologie. Ausserdem mag ich nicht, wenn dafür Tierversuche eingesetzt werden.
Und sonst erinnert mich diese Kontaktlinse etwas an die Borg aus Star Trek. Die halb Mensch und halb Maschinen sind. Das ist zwar nicht so tragisch, aber sie erobern und assimilieren andere Lebewesen. (diese Lebewesen sind dann auch Borg)
 

PSYCHOBUBE

Bekanntes Gesicht
Als Augenprothese für Blinde oder Menschen mit Augenproblemen wäre eine gute Erfindung.

Sonst ziehe ich lieber mein PC oder Handy und co. vor. Könnte zwar bei Ausritten nützlich sein, wenn es ein Notfall gibt dass man schnell jemand erreicht. Vom Pferd aus zu telefonieren ist nicht so einfach wenn man im Gelände ist. (musste paarmal anrufen, weil ich mich verirrt hatte)

Trotzdem warte ich erst auf so einer Linse, wenn ich Augenprobleme habe und die Linse mir helfen kann.

Übringens die Linsen wurden schon an Versuchskaninchen auf Unverträglichkeiten getestet. Stand in den Artikel bei GMX.
 

Crystalchild

Bekanntes Gesicht
(Ich war mir sicher ich hatte hier gepostet, aber anscheinend doch nicht.. hmh.)

Als Ausgleich für Defizite (Amputierte Gliedmaßen, Erblindete Menschen, etc.) eine Klasse Sache, aber sobald man Wände mit nem Titaniumarm durchschlägt bekähme ich Angst ^^, denn wenn die Technologie zur Verfügung steht Kraft und Kapazität eines Menschen zu erhöhen, würde sie Missbraucht werden. Man stelle sich Augmentierte Kriminelle vor. ".. hachjoa, dann mach ich mal das Krankenhaus kaputt.. *FALCON, PUNCH!* ,, nah, ich hoffe um's gemeinwohl dass 'soetwas' nicht passieren wird. (Aber die Chancen sind mehr als gegeben.)

(Edit: Das errinert mich an die Typen die in Deus Ex die ersten Minuten des Spiels aufmischen.. *Schauder* .. ich muss das Game mal weiterzocken.)
 

ThreeSix187

Bekanntes Gesicht
Ehrlich, wer hat nicht auf so eine Linse gewartet?
Nur hättest du dann so ein Problem wie bei "Minority Report" mit Tom Cruise. Dort werden die Augen von der Werbetafel gescannt und jeder Mensch wird mit noch mehr Werbungsmüllspam zugetextet. :|
Ob wir wirklich bald alle wie Kano aus Mortal Kombat mit seinem künstlichen Auge rumlaufen können wage ich aber immernoch zu bezweifeln, da die wahrscheinlich verwendete Technik mit organischen LEDs (OLED) noch nicht wirklich ausgereift ist.3
 

PSYCHOBUBE

Bekanntes Gesicht
Ausserdem wäre auch die Gefahr eine 2 Klassengesellschaft zu haben noch größer. Die, die sich so eine Technologie leisten können, würden so eine Art "Supermenschen" werden, und alle anderen sind dann nur noch 2. Klasse. Und werden ziemlich schnell von den "Supermenschen" unterdrückt. So etwas liegt ja in der Natur des Menschen. Krass ist es schon, wenn man "nur" wegen Kleidung von einer Gesellschaft ausgeschlossen wird. Aber wenn es um solche Technologien geht. o.O. Kann gefährlich werden.
 

Desardh

Senior Community Officer
Teammitglied
Zeit, den Thread für einen interessanten, vielleicht auch beängstigenden Artikel der Zeit auszugraben:
Zukunftsvision: Die analoge Welt ist nur die halbe Realität | Digital | ZEIT ONLINE

"Google plant unsichtbare Computer und ein allgegenwärtiges Netz – "Augmented reality" wird zum Standard. Wer das nicht will, dem bleibt nur eine "reduced reality"."

Was Google selbst für finstere Intentionen hat, sei mal dahin gestellt und wenn das die Zukunft ist, muss es nicht einmal Google sein, das uns dorthin bringt. Viel wichtiger ist aber die Frage, ob es grundsätzlich eine gute oder eine schlechte Sache ist, dass die digitale Welt mit der Realität verschmilzt und allgegenwärtig ist. Macht es das Leben einfacher? Oder führt das zu einer ungesunden Abhängigkeit, welche am Ende nur zu Realitätsverlust führt und die Menschheit spaltet?

"Denn je unauffälliger der Computer als Schnittstelle zwischen analoger Welt und digitaler Information wird, desto mehr werden sich beide Ebenen überlagern. Und das wird letztlich den Begriff Realität verändern."

Würde mich mal interessieren, was ihr davon haltet. Nicht nur im Bezug auf den Datenschutz. In dem Sinne ist es natürlich eine böse, böse Sache, das ist klar.
 

Foxioldi

Bekanntes Gesicht
Das würde denen allen schon gefallen - einen total gläsernen Menschen zu haben und noch weiter Kohle damit machen - da soll sich mal keiner mehr über die Stasi aufregen!

Aber halbgläserne Menschen sind wir eigentlich schon längst.

Manchmal macht mir die Zukunft schon einbißchen Angst - habe manchmal das Gefühl, daß der Mensch sich selbst immer mehr in Ketten legt, wobei wieder einige nur fette Konten sich anlegen...:B, und Sklaven der eigenen Technik sind wir auch schon teilweise, aber es sollte zumindest nicht weiter ausarten!

Digitale Welt, schön und gut, solange jeder Einzelne noch selbst bestimmen kann, wie weit er in diese Materie eindringen und diese nutzen möchte.

Alles andere würde ein Rückschritt in die Sklavenhaltergesellschaft für mich bedeuten, dann würde auch kein Mensch hier auf der Erde mehr anzutreffen sein, sondern wieder der Homo sapiens....

Aber solche ähnlichen Meldungen werden wir in der Zukunft noch öfters bekommen, vielfach ist es auch nur ein Wuschdenken und man sollte da nicht so ernsthaft sich in solchen Sachen reinsteigern, sondern einfach nur in der Realität bleiben.
 
Zuletzt bearbeitet:

PSYCHOBUBE

Bekanntes Gesicht
hört sich alles so an wie ein Sci-Fi Thriller. Bei aller Liebe zur Technik, finde ich die Smartphones fast schon zuviel. Ich muss nicht jederzeit ins Internet wenn ich unterwegs bin. und neulich hörte ich in der Werbung von einem App, dass einen Anleitungen gibt, um besser zähne zu putzen. Es gibt auch sinnvolle Apps, z.B. schnell eine Busverbindung und co. herauszufinden. Oder eben Navigation, selbst wenn bei Spiele, Musik, Bilder und Videos, das ist alles noch im Rahmen. Aber für jede Kleinigkeit werden neue Apps erschaffen..

ich sehe so: Ich möchte eine für mich eine klare Linie zwischen realität und Technikwelt. Entweder widme ich z.B. eine Stunde bewusst Konsole oder PC (Internet inklusiv), bzw. wenn ich gerade irgendwo hinfahre oder ich muss warten etc. auch in den Augenblicken bin ich dann auf die Technik konzentriert . Oder ich konzentriere Realtät, besuche Freunde, reite, etc. und in den momenten und dann hat die Technik nichts in meinem Kopf zu suchen. Ein Handy ist für mich zur Kommunikation da, zum Spielen oder lesen, nutze ich den 3DS oder ein Buch. wenn bereits ein Spiel auuf mein Handy ist, dass mir gefällt. dann spiele ich es auch. Oder wenn mein handy Funktion für Bilder zu machen hätte. Aber es nicht das wichtigste.

Mir geht es darum dass zwischen Technikwelt und Realität eine klare Linie besteht.

dieser artikel macht einen echt Angst. wo bleibt die Privatsphäre? kann man wenigstens, falls man sowas hat, das ganze auch mal abschalten.
Es erinnert mich irgendwie an die Borg aus Star Trek. die sind auch alle miteinander verbunden. anders, aber sie sind ein kollektiv. Jeder Borg hört die stimmen der anderen des Kollektives.
und so eine technologie könnte viel Schaden anrichten.
 

LOX-TT

Senior Community Officer
Teammitglied
das hört sich extrem SciFi an, Minority Report mäßig

auf so ne Zukunft kann ich gut und gerne verzichten :|
 

PSYCHOBUBE

Bekanntes Gesicht
Wenn man sich zum Cyborg machen lassen kann, werde ich einer der ersten sein, der dabei ist! :B

solange du nicht anfängst uns zu assimilieren :B


wenn uns eine Sci-Fi Thriller Zukunft droht, dann hoffe ich dass es auch Helden gibt, die solche Technologien zerstören. So wie der Protagonist in Minority Report, die Pre-Crime Technologie zu Fall bringt
 

GF0P

Bekanntes Gesicht
Blinde sehend, Taube hörend, Prothesen mit Tastsinn ... Transhumanismus an der Grenze zu den Cyborgs aus SciFi-Literatur? Oder moderne Medizin?
Wo fängt Transhumanismus an, wo hört Medizin auf?
Was ist mit Herz-, Hirn- und Lungenschrittmachern, die schon seit Jahrzehnten erfolgreich implantiert werden?

Wahrscheinlich wird man in Zukunft trennen müssen zwischen medizinisch notwendigen "Modifikationen" und Modifikationen, welche technikverrückte Trendsetter freiwillig an sich durchführen lassen, so wie es heute bereits in der plastischen Chirurgie praktiziert wird. Das wiederherstellen einer Nase-Wangenknochenpartie nach einem schlimmen Unfall oder das Modellieren von künstlichen Brüsten nach Brustkrebs steht in seinem Nutzen im krassen Gegensatz zum Schönheitswahn (größer, dünner, straffer).
Neulich habe ich auf dem Discoverychannel einen Bericht darüber gesehen, das Neuroports wie in Matrix oder der Otherland-Saga theoretisch bereits möglich sind und auch der technischen Umsetzung stehen im Grunde nur die extremen Komplikationsgefahren entgegen.
Auf diesem Wege könnten künstliche Erlebnisse und somit Erinnerungen geschaffen werden, welche das Gehirn nicht von echten Erfahrungen unterscheiden kann! 2 Wochen Südseeurlaub in der Mittagspause? Kein Problem! Total Recall und Inception lassen Grüßen!

Heute und in Zukunft wird nicht länger die Technologie der Entwicklung die Grenzen setzen, sondern die Moral und Ethik!
 

Desardh

Senior Community Officer
Teammitglied
Digitale Daten in DNA gespeichert - "Data Storage in DNA Becomes a Reality"

Wissenschaftler haben 739 Kilobyte an Daten in DNA gespeichert und zu 100% wiederherstellen können. Sie haben die aus Einsen und Nullen bestehenden Daten zu einem genetischen Code umgewandelt, sodass sie in Erbinformationen gespeichert werden konnten. Ohne Fehler konnten sie die Daten wieder herstellen. Das besondere daran ist, dass DNA nicht nur eine gigantische Kapazität besitzt (ein Gramm DNA = eine Millionen CD's), sondern auch haltbarer und zuverlässiger ist, als aktuelle Datenspeicher. Einziger Knackpunkt ist der Preis, da dieses Verfahren sehr teuer ist. Etwas, das sich in Zukunft natürlich ändern kann und sicherlich wird.
 

n-zoneAffe

Bekanntes Gesicht
Geile Sache :X
Ich glaube irgendwelche verrückten Profs haben sogar einmal den Binärcode eines Kinderliedes in eine Bakterie reingebastelt^^
 

r3tr0

Bekanntes Gesicht
Researchers at the J Craig Venter Institute recently unveiled their first self-replicating synthetic bacteria (M. mycoides JCVI-syn1.0) whose DNA was ‘programmed’ base pair by base pair. To verify that they had synthesized a new organism and not assembled the DNA from another natural bacteria, scientists encoded a series of ‘watermarks’ into the genes of M. mycoides JCVI-syn1.0. There are four of these hidden messages: an explanation of the coding system used, a URL address for those who crack the code to go visit, a list of 46 authors and contributors, and a series of famous quotes. [...]

  • CRAIGVENTER coded as:
    TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
  • VENTERINSTITVTE coded as:
    TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA
  • HAMSMITH coded as:
    TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA
  • CINDIANDCLYDE coded as:
    TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTC
    GATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG
  • GLASSANDCLYDE coded as:
    TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA
[...] To make things even clearer, JCVI also released the quotes used in the fourth watermark. Here they are:

  • “TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE.” – from James Joyce’s A Portrait of the Artist as a Young Man.
  • SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE.”- a quote from the book, American Prometheus which discusses J. Robert Oppenheimer and the first atomic bomb.
  • “WHAT I CANNOT BUILD, I CANNOT UNDERSTAND.” – attributed to Richard Feynman (physicist, philosopher, badass) as the last words on his blackboard at the time of his death as described in The Universe in a Nutshell by Stephen Hawking (physicist, philosopher, badass)
Quelle
 

n-zoneAffe

Bekanntes Gesicht
Es wäre auch sehr interessant wenn man Geräte bzw Programme entwickelt, die direkt Daten aus dem Gehirn aufnehmen. Nicht etwa um Menschen auszuspionieren, sondern um herauszufinden wie geistig Behinderte, Wachkomapatienten oder psychisch Erkrankte konkret denken und fühlen. Das würde wohl so manches erleichtern.
In einem Land wie Deutschland ist sowas allerdings wohl schwer zu realisieren, dafür sind die Grenzen der heimischen Ethik wohl etwas zu streng. ;)
 

ParakoopaReloaded

Bekanntes Gesicht
"Scheiß auf Ethik, ich will ein Cyborg werden."
Meine Meinung zu dem Thema...

Naja, ganz so simpel ist es wohl nicht, da ich dann nicht auf einmal von irgendwem kontrolliert werden möchte oder so, aber grundsätzlich bin ich voll für Forschung in dem Bereich. :)
 
Oben