Technologie, Transhumanismus, Augmented Reality

GF0P

Bekanntes Gesicht
Blinde sehend, Taube hörend, Prothesen mit Tastsinn ... Transhumanismus an der Grenze zu den Cyborgs aus SciFi-Literatur? Oder moderne Medizin?
Wo fängt Transhumanismus an, wo hört Medizin auf?
Was ist mit Herz-, Hirn- und Lungenschrittmachern, die schon seit Jahrzehnten erfolgreich implantiert werden?

Wahrscheinlich wird man in Zukunft trennen müssen zwischen medizinisch notwendigen "Modifikationen" und Modifikationen, welche technikverrückte Trendsetter freiwillig an sich durchführen lassen, so wie es heute bereits in der plastischen Chirurgie praktiziert wird. Das wiederherstellen einer Nase-Wangenknochenpartie nach einem schlimmen Unfall oder das Modellieren von künstlichen Brüsten nach Brustkrebs steht in seinem Nutzen im krassen Gegensatz zum Schönheitswahn (größer, dünner, straffer).
Neulich habe ich auf dem Discoverychannel einen Bericht darüber gesehen, das Neuroports wie in Matrix oder der Otherland-Saga theoretisch bereits möglich sind und auch der technischen Umsetzung stehen im Grunde nur die extremen Komplikationsgefahren entgegen.
Auf diesem Wege könnten künstliche Erlebnisse und somit Erinnerungen geschaffen werden, welche das Gehirn nicht von echten Erfahrungen unterscheiden kann! 2 Wochen Südseeurlaub in der Mittagspause? Kein Problem! Total Recall und Inception lassen Grüßen!

Heute und in Zukunft wird nicht länger die Technologie der Entwicklung die Grenzen setzen, sondern die Moral und Ethik!
 
TE
TE
Desardh

Desardh

Senior Community Officer
Teammitglied
Digitale Daten in DNA gespeichert - "Data Storage in DNA Becomes a Reality"

Wissenschaftler haben 739 Kilobyte an Daten in DNA gespeichert und zu 100% wiederherstellen können. Sie haben die aus Einsen und Nullen bestehenden Daten zu einem genetischen Code umgewandelt, sodass sie in Erbinformationen gespeichert werden konnten. Ohne Fehler konnten sie die Daten wieder herstellen. Das besondere daran ist, dass DNA nicht nur eine gigantische Kapazität besitzt (ein Gramm DNA = eine Millionen CD's), sondern auch haltbarer und zuverlässiger ist, als aktuelle Datenspeicher. Einziger Knackpunkt ist der Preis, da dieses Verfahren sehr teuer ist. Etwas, das sich in Zukunft natürlich ändern kann und sicherlich wird.
 

n-zoneAffe

Bekanntes Gesicht
Geile Sache :X
Ich glaube irgendwelche verrückten Profs haben sogar einmal den Binärcode eines Kinderliedes in eine Bakterie reingebastelt^^
 

r3tr0

Bekanntes Gesicht
Researchers at the J Craig Venter Institute recently unveiled their first self-replicating synthetic bacteria (M. mycoides JCVI-syn1.0) whose DNA was ‘programmed’ base pair by base pair. To verify that they had synthesized a new organism and not assembled the DNA from another natural bacteria, scientists encoded a series of ‘watermarks’ into the genes of M. mycoides JCVI-syn1.0. There are four of these hidden messages: an explanation of the coding system used, a URL address for those who crack the code to go visit, a list of 46 authors and contributors, and a series of famous quotes. [...]

  • CRAIGVENTER coded as:
    TTAACTAGCTAATGTCGTGCAATTGGAGTAGAGAACACAGAACGATTAACTAGCTAA
  • VENTERINSTITVTE coded as:
    TTAACTAGCTAAGTAGAAAACACCGAACGAATTAATTCTACGATTACCGTGACTGAGTTAACTAGCTAA
  • HAMSMITH coded as:
    TTAACTAGCTAACATGCAATGTCGATGATTACCCACTTAACTAGCTAA
  • CINDIANDCLYDE coded as:
    TTAACTAGCTAATGCATAAACGACATCGCTAATGACTGTCTTTATGATGAATTAACTAGCTAATGGGTC
    GATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAAACATCATG
  • GLASSANDCLYDE coded as:
    TTAACTAGCTAAGGTCTAGCTAGTAGCGCGAATGACTGCCTATACGATGAG TTAACTAGCTAA
[...] To make things even clearer, JCVI also released the quotes used in the fourth watermark. Here they are:

  • “TO LIVE, TO ERR, TO FALL, TO TRIUMPH, TO RECREATE LIFE OUT OF LIFE.” – from James Joyce’s A Portrait of the Artist as a Young Man.
  • SEE THINGS NOT AS THEY ARE, BUT AS THEY MIGHT BE.”- a quote from the book, American Prometheus which discusses J. Robert Oppenheimer and the first atomic bomb.
  • “WHAT I CANNOT BUILD, I CANNOT UNDERSTAND.” – attributed to Richard Feynman (physicist, philosopher, badass) as the last words on his blackboard at the time of his death as described in The Universe in a Nutshell by Stephen Hawking (physicist, philosopher, badass)
Quelle
 

n-zoneAffe

Bekanntes Gesicht
Es wäre auch sehr interessant wenn man Geräte bzw Programme entwickelt, die direkt Daten aus dem Gehirn aufnehmen. Nicht etwa um Menschen auszuspionieren, sondern um herauszufinden wie geistig Behinderte, Wachkomapatienten oder psychisch Erkrankte konkret denken und fühlen. Das würde wohl so manches erleichtern.
In einem Land wie Deutschland ist sowas allerdings wohl schwer zu realisieren, dafür sind die Grenzen der heimischen Ethik wohl etwas zu streng. ;)
 

ParakoopaReloaded

Bekanntes Gesicht
"Scheiß auf Ethik, ich will ein Cyborg werden."
Meine Meinung zu dem Thema...

Naja, ganz so simpel ist es wohl nicht, da ich dann nicht auf einmal von irgendwem kontrolliert werden möchte oder so, aber grundsätzlich bin ich voll für Forschung in dem Bereich. :)
 

PSYCHOBUBE

Bekanntes Gesicht
Es wäre auch sehr interessant wenn man Geräte bzw Programme entwickelt, die direkt Daten aus dem Gehirn aufnehmen. Nicht etwa um Menschen auszuspionieren, sondern um herauszufinden wie geistig Behinderte, Wachkomapatienten oder psychisch Erkrankte konkret denken und fühlen. Das würde wohl so manches erleichtern.
In einem Land wie Deutschland ist sowas allerdings wohl schwer zu realisieren, dafür sind die Grenzen der heimischen Ethik wohl etwas zu streng. ;)

Meine Meinungen:

Pro:
solche Geräte können nützlich sein. Gerade bei wachkoma Patienten oder diejenigen die an einem Locked-In Syndrom leiden (was mir persönlich noch mehr Angst macht als Wachkoma. )

Könnte auch als Universal-Übersetzer benutzt werden. Und ich würde es interessant finden was andere Tierarten WIRKLICH denken und was nicht. Und ob wir deren Gedanken verstehen können.

Contra: Aber nicht für Psychisch Kranke oder Behinderte. Es seih denn, es ist deren Wunsch. Ich möchte nicht, dass ein Computer meine Gedanken liest. Einmal wegen Zwangsgedanken, die mir zu. Teil sehr peinlich sind. Und dann auch weil meine gedanken Privatsphäre ist und so bleiben soll.

Ausserdem kann so eine Technologie in falsche hände geraten. Und dann wird es richtig gefährlich
 

PSYCHOBUBE

Bekanntes Gesicht
Jede Technologie kann ich falsche Hände geraten. Man siehe nur mal Alfred Nobel und sein Dynamit. %)

Oder die Atombombe. Hier ein Ausschnitt aus Wikipedia über Albert Einstein:

Einsteins Unterschrift zur Atombombe [Bearbeiten]
Die Entdeckung der Kernspaltung 1938 durch Otto Hahn und Lise Meitner in Berlin beschwor in der Wissenschaftsgemeinde die Erkenntnis einer nuklearen Bedrohung herauf. Im August 1939, kurz vor Beginn des Zweiten Weltkriegs, unterzeichnete Einstein einen von Leo Szilard verfassten Brief an den amerikanischen Präsidenten Franklin D. Roosevelt, der vor der Gefahr einer Bombe neuen Typs warnte, die Deutschland möglicherweise entwickle und gar bald besitze.[24] Der Appell wurde erhört, zusätzliche Forschungsgelder wurden bereitgestellt: Das Manhattan-Projekt mit dem erklärten Ziel der Entwicklung einer Atombombe war aus der Taufe gehoben. In seinen persönlichen Memoiren vertritt Einstein die Auffassung, dass er sich zu leichtfertig von der Notwendigkeit der Unterzeichnung dieses Briefes überzeugen ließ.
An den Arbeiten war Einstein jedoch gänzlich unbeteiligt: Seine wissenschaftlichen Prioritäten setzte er auf anderen Gebieten; nicht zuletzt war er ein langjähriger Zweifler an der die Nukleartechnik erst ermöglichenden Quantentheorie. Obendrein wurde er wegen seiner unverhüllten Sympathien für den Kommunismus als Sicherheitsrisiko eingestuft und von den US-amerikanischen Geheimdiensten beobachtet. Nach Kriegsende engagierte sich Einstein für internationale Rüstungskontrolle.
 
Oben